ThaumatinL, ThaumatinL (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	ThaumatinL
Genbank ID	CD860773
Type	SSCP
Species	Pisum sativum
Primer 1	ThaumatinL.Forward Primer: hTCATTTGTTTAACTCACTCCCAAA
Primer 2	ThaumatinL.Reverse Primer: GACGATGTCAAACCTTGCTG
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	CD860773

Publications


Year	Publication
2006	Aubert G, Morin J, Jacquin F, Loridon K, Quillet M, Petit A, Rameau C, Lejeune-Hénaut I, Huguet T, Burstin J. Functional mapping in pea, as an aid to the candidate gene selection and for investigating synteny with the model legume Medicago truncatula. Theoretical and applied genetics. 2006; 112(6):1024-1041.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-compositeMap-2006	LGVII	N/A	39	ThaumatinL	View
2	pea-consensusMap-2011	LGVII	N/A	17.2	ThaumatinL	View