|
Marker Overview
Name | JF1-AG3 |
Genbank ID | N/A |
Type | SSR |
Species | Vicia faba |
Repeat Motif | (GA)5TA(GA)4TA(GA)11 |
Primer 1 | JF1-AG3.Forward Primer: ATGATGAGGATGCAGGATCGA |
Primer 2 | JF1-AG3.Reverse Primer: TAATTTGTTGGTCTCAGTGC |
Product Length | 350 |
Publication | [view all] |
Publications
Year | Publication |
2004 | Avila C, Satovic Z, Sillero J, Rubiales D, Moreno M, Torres A. Isolate and organ-specific QTLs for ascochyta blight resistance in faba bean (Vicia faba L.). Theoretical and applied genetics. 2004; 108(6):1071-1078. |
2002 | Pozarkova D, Koblizkova A, Roman B, Torres AM, Lucretti S, Lysak M, Dolezel J, Macas J. Development and Characterization of Microsatellite Markers from Chromosome 1-Specific DNA Libraries of Vicia faba. 2002; 45(3):337-345. |
|