GLLC511, GLLC511 (genetic_marker) Lens culinaris

Name	GLLC511
Genbank ID	N/A
Type	SSR
Species	Lens culinaris
Primer 1	GLLC511.Forward Primer: ATTGAGAGGAGGCGGAGAA
Primer 2	GLLC511.Reverse Primer: CGCGTGTCTCTCTCTCTCAC
Publication	[view all]
Contact	Gopesh Saha Abhishek Bohra

Name	Details
Gopesh Saha	First name: Gopesh Last name: Saha Institution: USDA-ARS Address: Grain Legume Genetics and Physiology Research Unit, USDA-ARS, Washington State University, Pullman, WA Country: USA Email: gopesh_saha@wsu.edu
Abhishek Bohra	First name: Abhishek Last name: Bohra Title: Researcher Institution: Indian Institute of Pulses Research Address: Crop Improvement DivisionIndian Institute of Pulses ResearchKanpurIndia Country: India Email: abhi.omics@gmail.com Last update: Mar 2017

Year	Publication
2010	Saha GC, Sarker A, Chen W, Vandemark GJ, Muehlbauer FJ. Inheritance and Linkage Map Positions of Genes Conferring Resistance to Stemphylium Blight in Lentil. Crop science. 2010; 50(5):1831-1839.
2017	Jha R, Bohra A, Jha UC, Rana M, Chahota RK, Kumar S, Sharma TR. Analysis of an intraspecific RIL population uncovers genomic segments harbouring multiple QTL for seed relevant traits in lentil (Lens culinaris L.). Physiology and molecular biology of plants : an international journal of functional plant biology. 2017 Jul; 23(3):675-684.

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	lentil-ILL6002xILL5888-F7-RIL	LG12	N/A	23.5	GLLC511b	View
2	lentil-ILL6002xILL5888-F7-RIL	LG8	N/A	47.2	GLLC511a	View
3	Lentil-WA864909_x_Precoz-RIL-2017	LG7	N/A	63.4	GLLC511	View
4	Lentil-WA8649090/Precoz-F10-RIL	LG05	N/A	64.9	GLLC511	View