LcSSR176, LcSSR176 (genetic_marker) Lens culinaris

Marker Overview
NameLcSSR176
Genbank IDJF768341
TypeSSR
SpeciesLens culinaris
Repeat Motif(ATT)…3(GT)15…(GA)15
Primer 1LcSSR176.Forward Primer: CCCCTATTATCATTATTGGTGCT
Primer 2LcSSR176.Reverse Primer: AGGGAAATCCTCACTACCCATT
Publication[view all]
ContactSabhyata Bhatia
Abhishek Bohra
References
External references for this genetic_marker
DatabaseAccession
DB:genbankJF768341
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerLcSSR176.Forward PrimerLens culinarisprimer
Reverse PrimerLcSSR176.Reverse PrimerLens culinarisprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Seed thicknessqSDTH.WA864909_x_Precoz.LG8.1Lens culinarisQTL
Seed thicknessqSDTH.WA864909_x_Precoz.LG8.2Lens culinarisQTL
Seed plumpnessqSDPLMP.WA864909_x_Precoz.LG8Lens culinarisQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
LcSSR176LcSSR176Lens culinarismarker_locus


Contact
NameDetails
Sabhyata Bhatia
First name:Sabhyata
Last name:Bhatia
Title:Researcher
Institution:National Institute of Plant Genome Research
Address:Aruna Asaf Ali Marg, PO Box 10531, New Delhi 110067, India
Country:India
Email:sabhyata_bhatia@nipgr.res.in
Phone:91 11-26735159
Fax:91 11-26741658
Last update:Dec 2015
Abhishek Bohra
First name:Abhishek
Last name:Bohra
Title:Researcher
Institution:Indian Institute of Pulses Research
Address:Crop Improvement DivisionIndian Institute of Pulses ResearchKanpurIndia
Country:India
Email:abhi.omics@gmail.com
Last update:Mar 2017
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1lentil-PrecozxL830-RILLG1N/A51.3LcSSR176View
2Lentil_Precoz_x_L830_RILLG1N/A51.3LcSSR176View
3Lentil-WA864909_x_Precoz-RIL-2017LG8N/A31.4LcSSR176View