LcSSR621, LcSSR621 (genetic_marker) Lens culinaris | PulseDB

Marker Overview

Marker Overview


Name	LcSSR621
Genbank ID	KJ470816
Type	SSR
Species	Lens culinaris
Repeat Motif	(GAA)4...(GAA)6
Primer 1	LcSSR621.Forward Primer: CTTTGAGAGACCACAATTT
Primer 2	LcSSR621.Reverse Primer: GACGTTTAAGCATAACAAAC
Product Length	357
Publication	[view all]
Contact	Sabhyata Bhatia

Contact

Name

Details

Sabhyata Bhatia

First name:	Sabhyata
Last name:	Bhatia
Title:	Researcher
Institution:	National Institute of Plant Genome Research
Address:	Aruna Asaf Ali Marg, PO Box 10531, New Delhi 110067, India
Country:	India
Email:	sabhyata_bhatia@nipgr.res.in
Phone:	91 11-26735159
Fax:	91 11-26741658
Last update:	Dec 2015

References

External references for this genetic_marker


Database	Accession
DB:genbank	KJ470816

Publications


Year	Publication
2015	Verma P, Goyal R, Chahota RK, Sharma TR, Abdin MZ, Bhatia S. Construction of a Genetic Linkage Map and Identification of QTLs for Seed Weight and Seed Size Traits in Lentil (Lens culinaris Medik.). 2015; 10(10):e0139666.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	lentil-PrecozxL830-RIL	LG6	N/A	109.6	LcSSR621	View
2	Lentil-WA8649090/Precoz-F10-RIL	LG03	N/A	109.3	LcSSR621	View