|
Marker Overview
Name | LcSSR66 |
Genbank ID | JF768231 |
Type | SSR |
Species | Lens culinaris |
Repeat Motif | (GA)13 |
Primer 1 | LcSSR66.Forward Primer: TCCTTGCTGAATTGCATGTT |
Primer 2 | LcSSR66.Reverse Primer: GAGCCACTGGTCCATTCATT |
Product Length | 266 |
Publication | [view all] |
Contact | Sabhyata Bhatia Abhishek Bohra
|
References
External references for this genetic_marker
Database | Accession |
DB:genbank | JF768231 |
Publications
Year | Publication |
2015 | Verma P, Goyal R, Chahota RK, Sharma TR, Abdin MZ, Bhatia S. Construction of a Genetic Linkage Map and Identification of QTLs for Seed Weight and Seed Size Traits in Lentil (Lens culinaris Medik.). 2015; 10(10):e0139666. |
2017 | Jha R, Bohra A, Jha UC, Rana M, Chahota RK, Kumar S, Sharma TR. Analysis of an intraspecific RIL population uncovers genomic segments harbouring multiple QTL for seed relevant traits in lentil (Lens culinaris L.). Physiology and molecular biology of plants : an international journal of functional plant biology. 2017 Jul; 23(3):675-684. |
|