LcSSR83, LcSSR83 (genetic_marker) Lens culinaris

Name	LcSSR83
Genbank ID	JF768248
Type	SSR
Species	Lens culinaris
Repeat Motif	(CT)12(CA)14
Primer 1	LcSSR83.Forward Primer: TGGTTCACCAAAATGTATAATGC
Primer 2	LcSSR83.Reverse Primer: CCTTCAATCTTAGGTAACTGCTACG
Product Length	229
Publication	[view all]
Contact	Sabhyata Bhatia Abhishek Bohra

Name	Details
Sabhyata Bhatia	First name: Sabhyata Last name: Bhatia Title: Researcher Institution: National Institute of Plant Genome Research Address: Aruna Asaf Ali Marg, PO Box 10531, New Delhi 110067, India Country: India Email: sabhyata_bhatia@nipgr.res.in Phone: 91 11-26735159 Fax: 91 11-26741658 Last update: Dec 2015
Abhishek Bohra	First name: Abhishek Last name: Bohra Title: Researcher Institution: Indian Institute of Pulses Research Address: Crop Improvement DivisionIndian Institute of Pulses ResearchKanpurIndia Country: India Email: abhi.omics@gmail.com Last update: Mar 2017

Database	Accession
DB:genbank	JF768248

Aligned Feature	Feature Type	Alignment Location
Lcu.2RBY.Chr6	supercontig	Lcu.2RBY.Chr6:359617605..359617843 .

Year	Publication
2015	Verma P, Goyal R, Chahota RK, Sharma TR, Abdin MZ, Bhatia S. Construction of a Genetic Linkage Map and Identification of QTLs for Seed Weight and Seed Size Traits in Lentil (Lens culinaris Medik.). 2015; 10(10):e0139666.
2017	Jha R, Bohra A, Jha UC, Rana M, Chahota RK, Kumar S, Sharma TR. Analysis of an intraspecific RIL population uncovers genomic segments harbouring multiple QTL for seed relevant traits in lentil (Lens culinaris L.). Physiology and molecular biology of plants : an international journal of functional plant biology. 2017 Jul; 23(3):675-684.

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	lentil-L830xILWL77-F2	LGIX	N/A	232.1	LCSSR83	View
2	lentil-PrecozxL830-RIL	LG3	N/A	64.9	LCSSR83	View
3	Lentil-WA864909_x_Precoz-RIL-2017	LG5	N/A	53.2	LCSSR83	View
4	Lentil-WA8649090/Precoz-F10-RIL	LG03	N/A	34.5	LCSSR83	View