|
|
Marker Overview
| Name | PBA_LC_0219 |
|---|
| Genbank ID | N/A |
|---|
| Type | EST-SSR |
|---|
| Species | Lens culinaris |
|---|
| Repeat Motif | GAA(4) |
|---|
| Primer 1 | PBA_LC_0219.Forward primer: TAGCAAATGGACGTGTAGAGT |
|---|
| Primer 2 | PBA_LC_0219.Reverse primer: GTGGTGCTCAATACACAATCT |
|---|
| Product Length | 166 |
|---|
| Publication | [view all] |
|---|
| Contact | John W. Forster
Sukhjiwan Kaur
|
|---|
Publications
| Year | Publication |
|---|
| 2011 | Kaur S, Cogan NO, Pembleton LW, Shinozuka M, Savin KW, Materne M, Forster JW. Transcriptome sequencing of lentil based on second-generation technology permits large-scale unigene assembly and SSR marker discovery. BMC genomics. 2011; 12:265. |
| 2016 | Sudheesh S, Rodda MS, Davidson J, Javid M, Stephens A, Slater AT, Cogan NO, Forster JW, Kaur S. SNP-Based Linkage Mapping for Validation of QTLs for Resistance to Ascochyta Blight in Lentil. Frontiers in plant science. 2016; 7:1604. |
|
