SNP_60000330, SNP_60000330 (genetic_marker) Lens culinaris

Marker Overview
NameSNP_60000330
dbSNP IDN/A
TypeSNP
SNP AllelesN/A
5' Flanking SequenceGGAGTTAGGTTGAGAATTGAGGGAAAGCAATCCCAGATTTGGACTCAAGGCGAAAAATCG AGTGTATATTGACCAAATATTTTGAGGTTTGGTCATCACC
3' Flanking SequenceAAGCGATTTCCAATGCCCAGAATGCAGGTT
SpeciesLens culinaris
Publication[view all]
ContactJohn W. Forster
Sukhjiwan Kaur
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SNP_60000330SNP_60000330Lens culinarismarker_locus


Contact
NameDetails
John W. Forster
First name:John
Last name:Forster
Institution:La Trobe University Research and Development Park
Address:Bundoora, VIC 3083, Australia
Country:Australia
Email:john.forster@depi.vic.gov.au
Sukhjiwan Kaur
First name:Sukhjiwan
Last name:Kaur
Title:Researcher
Institution:La Trobe University
Address:Biosciences Research, Agriculture Victoria, AgriBio, La Trobe University, Bundoora, VIC, Australia
Country:Australia
Email:sukhjiwan.kaur@ecodev.vic.gov.au
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1lentil-CassabxILL2024-F6LG3N/A65.1SNP_60000330View
2Lentil-Consensus-RIL-2016LG1N/A67.03SNP_60000330View
3Lentil-Indianhead_x_Northfield-RIL-2016LG1N/A45.4SNP_60000330View
4Lentil-Indianhead_x_Digger-RIL-2016LG1N/A46.4SNP_60000330View
Sequence
>SNP_60000330 ID=SNP_60000330|Name=SNP_60000330|organism=Lens culinaris|type=genetic_marker|length=131bp
GGAGTTAGGTTGAGAATTGAGGGAAAGCAATCCCAGATTTGGACTCAAGG
CGAAAAATCGAGTGTATATTGACCAAATATTTTGAGGTTTGGTCATCACC
RAAGCGATTTCCAATGCCCAGAATGCAGGTT