SSR317-2, SSR317-2 (genetic_marker) Lens culinaris

Name	SSR317-2
Genbank ID	N/A
Type	SSR
Species	Lens culinaris
Repeat Motif	(TTG)2(AT)2A(AT)2G(TA)14ATC(GT)4
Primer 1	SSR317-2.Forward Primer: CACGTAACATCTTGCTTATG
Primer 2	SSR317-2.Reverse Primer: GTAGCAATAATTACACCCAC
Product Length	120
Publication	[view all]
Contact	Michael Baum Sukhjiwan Kaur

Name	Details
Michael Baum	First name: Michael Last name: Baum Institution: International Centre for Agricultural Research in the Dry Areas Address: ICARDA, PO Box 5466, Aleppo, Syria Country: Syria Email: M.Baum@cgiar.org
Sukhjiwan Kaur	First name: Sukhjiwan Last name: Kaur Title: Researcher Institution: La Trobe University Address: Biosciences Research, Agriculture Victoria, AgriBio, La Trobe University, Bundoora, VIC, Australia Country: Australia Email: sukhjiwan.kaur@ecodev.vic.gov.au Last update: Apr 2018

Aligned Feature	Feature Type	Alignment Location
Lcu.2RBY.Chr2	supercontig	Lcu.2RBY.Chr2:275639755..275639875 .

Year	Publication
2005	Hamwieh A, Udupa SM, Choumane W, Sarker A, Dreyer F, Jung C, Baum M. A genetic linkage map of Lens sp. based on microsatellite and AFLP markers and the localization of fusarium vascular wilt resistance. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Feb; 110(4):669-77.
2016	Sudheesh S, Rodda MS, Davidson J, Javid M, Stephens A, Slater AT, Cogan NO, Forster JW, Kaur S. SNP-Based Linkage Mapping for Validation of QTLs for Resistance to Ascochyta Blight in Lentil. Frontiers in plant science. 2016; 7:1604.

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	lentil-CassabxILL2024-F6	LG4.1	N/A	97.3	SSR317-2	View
2	lentil-ILL5588xL692-16-1-RIL	LG1	N/A	71.5	SSR317-2	View
3	lentil-L830xILWL77-F2	LGII	N/A	225.3	SSR317-2	View
4	Lentil-Consensus-RIL-2016	LG2	N/A	254.7	SSR317-2	View
5	Lentil- Northfield_x_Digger-RIL-2016	LG2.2	N/A	28.3	SSR317-2	View