|
Marker Overview
Name | mtmt_GEN_00768_01_1 |
Genbank ID | N/A |
Type | Indel |
Species | Medicago truncatula |
Primer 1 | mtmt_GEN_00768_01_1.Forward Primer: ATGGATTCAGAACCAGTGGC |
Primer 2 | mtmt_GEN_00768_01_1.Reverse Primer: GTCAGATTTCCCTCCAGCAG |
Publication | [view all] |
Alignments
The following features are aligned
Publications
Year | Publication |
2013 | Satovic Z, Avila CM, Cruz-Izquierdo S, Diaz-Ruiz R, Garcia-Ruiz M, Palomino C, Gutierrez N, Vitale S, Ocana-Moral S, Gutierrez MV, Cubero JI, Torres AM. A reference consensus genetic map for molecular markers and economically important traits in faba bean (Vicia faba L.). 2013; 14:932. |
|