|
|
Marker Overview
| Name | Pis_GEN_21_1_1 |
|---|
| Genbank ID | N/A |
|---|
| Type | PCR marker |
|---|
| Species | Pisum sativum |
|---|
| Primer 1 | Pis_GEN_21_1_1.Forward Primer: GTTGAAGATCCTTCCACCGA |
|---|
| Primer 2 | Pis_GEN_21_1_1.Reverse Primer: CTTCATTCGCAAATTCCCAT |
|---|
| Publication | [view all] |
|---|
Alignments
The following features are aligned
Publications
| Year | Publication |
|---|
| 2013 | Satovic Z, Avila CM, Cruz-Izquierdo S, Diaz-Ruiz R, Garcia-Ruiz M, Palomino C, Gutierrez N, Vitale S, Ocana-Moral S, Gutierrez MV, Cubero JI, Torres AM. A reference consensus genetic map for molecular markers and economically important traits in faba bean (Vicia faba L.). 2013; 14:932. |
|
