Pis_GEN_7_1_2_1, Pis_GEN_7_1_2_1 (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	Pis_GEN_7_1_2_1
Genbank ID	N/A
Type	Indel
Species	Pisum sativum
Primer 1	Pis_GEN_7_1_2_1.Forward Primer: TTGATGGCAGCTACAGCAAG
Primer 2	Pis_GEN_7_1_2_1.Reverse Primer: AGTGCTCCTAGCATAGCCCA
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr5LG3	supercontig	chr5LG3:492668750..492669362 .

Publications


Year	Publication
2013	Satovic Z, Avila CM, Cruz-Izquierdo S, Diaz-Ruiz R, Garcia-Ruiz M, Palomino C, Gutierrez N, Vitale S, Ocana-Moral S, Gutierrez MV, Cubero JI, Torres AM. A reference consensus genetic map for molecular markers and economically important traits in faba bean (Vicia faba L.). 2013; 14:932.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	faba-ConsensusMap_2013-RIL	LGI	N/A	44.13	Pis_GEN_7_1_2_1	View
2	faba-Vf6xVf136-F6	LGIA	N/A	43.8	Pis_GEN_7_1_2	View