O2like_gene, O2like_gene (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	O2like_gene
Genbank ID	B1311616
Type	gene marker
Species	Pisum sativum
Primer 1	O2like_gene.Forward Primer: GGAAGGTGTCCAACCGCGATTCTGC
Primer 2	O2like_gene.Reverse Primer: TGCTAGTCAAAGAGCTCACAGC
Restriction Enzyme	TagI
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	B1311616

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr6LG2	supercontig	chr6LG2:4115000..4115714 .

Publications


Year	Publication
2015	Coyne CJ, Pilet-Nayel ML, McGee RJ, Porter LD, Smykal P, Grunwald NJ. Identification of QTL controlling high levels of partial resistance to Fusarium solani f. sp. pisi in pea. Plant Breeding. 2015.