|
Marker Overview
Name | 742043 |
dbSNP ID | N/A |
Type | SNP |
SNP Alleles | G/A |
Species | Cicer arietinum |
Primer 1 | 742043.Forward primer: TCAATCAAAGAAACCCAACC |
Primer 2 | 742043.Reverse primer: TACAGAACAATCGCAGCTCT |
Publication | [view all] |
Contact | Stefano Pavan
|
References
External references for this genetic_marker
Database | Accession |
DB:genbank | reverse primer |
Publications
Year | Publication |
2017 | Pavan S, Lotti C, Marcotrigiano AR, Mazzeo R, Bardaro N, Bracuto V, Ricciardi F, Taranto F, D'Agostino N, Schiavulli A, De Giovanni C, Montemurro C, Sonnante G, Ricciardi L. A Distinct Genetic Cluster in Cultivated Chickpea as Revealed by Genome-wide Marker Discovery and Genotyping. The Plant Genome. 2017; 10. |
|