Ca-CNMS26, Ca-CNMS26 () Cicer sp. | PulseDB

Marker Overview

Marker Overview


Name	Ca-CNMS26
Genbank ID	28366947
Type	SSR
Species	Cicer sp.
Repeat Motif	(AG)8
Primer 1	Ca-CNMS26.Forward primer: TGCAGAGAAAGAGTGAGAAAG
Primer 2	Ca-CNMS26.Reverse primer: TGCTAACATCTTCAGTTCCTC
Product Length	152
Publication	[view all]
Contact	Swarup K. Parida

Contact

Name

Details

Swarup K. Parida

First name:	Swarup
Last name:	Parida
Institution:	National Institute of Plant Genome Research
Address:	Aruna Asaf Ali Marg, New Delhi 110067, India
Country:	India
Email:	swarup@nipgr.ac.in
Last update:	Apr 2018

References

External references for this genetic_marker


Database	Accession
DB:genbank	28366947

Publications


Year	Publication
2014	Bajaj D, Saxena MS, Kujur A, Das S, Badoni S, Tripathi S, Upadhyaya HD, Gowda CL, Sharma S, Singh S, Tyagi AK, Parida SK. Genome-wide conserved non-coding microsatellite (CNMS) marker-based integrative genetical genomics for quantitative dissection of seed weight in chickpea. Journal of experimental botany. 2014 Dec 10.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xICC17163-RIL	LG1	N/A	47.6	Ca-CNMS26	View