Ca-CNMS152, Ca-CNMS152 () Cicer sp.

Name	Ca-CNMS152
Genbank ID	28366828
Type	SSR
Species	Cicer sp.
Repeat Motif	(TCTA)3
Primer 1	Ca-CNMS152.Forward primer: TGCTCAATTTTTAGCTTCAAC
Primer 2	Ca-CNMS152.Reverse primer: ATCTGAAACAAGAGACCCACT
Product Length	166
Publication	[view all]
Contact	Swarup K. Parida

Name	Details
Swarup K. Parida	First name: Swarup Last name: Parida Institution: National Institute of Plant Genome Research Address: Aruna Asaf Ali Marg, New Delhi 110067, India Country: India Email: swarup@nipgr.ac.in Last update: Apr 2018

Database	Accession
DB:genbank	28366828

Feature Name	Type	Location	Analysis	Reference
Ca2	chromosome	Ca2:32955094..32955259 .	Cicer arietinum CDC Frontier genome v1.0	PCD marker alignment to genome using primer sequences
chr2	chromosome	chr2:32955094..32955259 .	Cicer arietinum CDC Frontier NCBI RefSeq v1	PCD marker alignment to genome using primer sequences

Year	Publication
2014	Bajaj D, Saxena MS, Kujur A, Das S, Badoni S, Tripathi S, Upadhyaya HD, Gowda CL, Sharma S, Singh S, Tyagi AK, Parida SK. Genome-wide conserved non-coding microsatellite (CNMS) marker-based integrative genetical genomics for quantitative dissection of seed weight in chickpea. Journal of experimental botany. 2014 Dec 10.

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xICC17163-RIL	LG3	N/A	16.7	Ca-CNMS152	View