Ca-CNMS293, Ca-CNMS293 () Cicer sp. | PulseDB

Marker Overview

Marker Overview


Name	Ca-CNMS293
Genbank ID	28366984
Type	SSR
Species	Cicer sp.
Repeat Motif	(CGT)5
Primer 1	Ca-CNMS293.Forward primer: TGGAAGATGGTTTATCCGCT
Primer 2	Ca-CNMS293.Reverse primer: ATCTGAGCCGAAGATTGAGG
Product Length	101
Publication	[view all]
Contact	Swarup K. Parida

Contact

Name

Details

Swarup K. Parida

First name:	Swarup
Last name:	Parida
Institution:	National Institute of Plant Genome Research
Address:	Aruna Asaf Ali Marg, New Delhi 110067, India
Country:	India
Email:	swarup@nipgr.ac.in
Last update:	Apr 2018

References

External references for this genetic_marker


Database	Accession
DB:genbank	28366984

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Ca4	chromosome	Ca4:32858163..32858263 .	Cicer arietinum CDC Frontier genome v1.0	PCD marker alignment to genome using primer sequences
chr4	chromosome	chr4:32858163..32858263 .	Cicer arietinum CDC Frontier NCBI RefSeq v1	PCD marker alignment to genome using primer sequences

Publications


Year	Publication
2014	Bajaj D, Saxena MS, Kujur A, Das S, Badoni S, Tripathi S, Upadhyaya HD, Gowda CL, Sharma S, Singh S, Tyagi AK, Parida SK. Genome-wide conserved non-coding microsatellite (CNMS) marker-based integrative genetical genomics for quantitative dissection of seed weight in chickpea. Journal of experimental botany. 2014 Dec 10.