|
|
Marker Overview
| Name | BMd-028 |
|---|
| Genbank ID | Z30345 |
|---|
| Type | SSR |
|---|
| Species | Phaseolus vulgaris |
|---|
| Repeat Motif | (GT)4 |
|---|
| Primer 1 | BMd-028.Forward: TGCATCAACTTTAGGAGCTTG |
|---|
| Primer 2 | BMd-028.Reverse: TCTTGTCTTATCAGCAGGTGGA |
|---|
| Product Length | 151 |
|---|
| Publication | [view all] |
|---|
| Contact | Matthew Blair
|
|---|
| Comment | Nodulin |
|---|
References
External references for this genetic_marker
| Database | Accession |
|---|
| DB:genbank | Z30345 |
Publications
| Year | Publication |
|---|
| 2003 | Blair MW, Pedraza F, Buendia HF, Gaitán-Solís E, Beebe SE, Gepts P, Tohme J. Development of a genome-wide anchored microsatellite map for common bean (Phaseolus vulgaris L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2003 Nov; 107(8):1362-74. |
| 2010 | Blair MW, Medina JI, Astudillo C, Rengifo J, Beebe SE, Machado G, Graham R. QTL for seed iron and zinc concentration and content in a Mesoamerican common bean (Phaseolus vulgaris L.) population. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2010 Oct; 121(6):1059-70. |
|
