|
Marker Overview
Name | BMd-042 |
Genbank ID | AZ301511 |
Type | SSR |
Species | Phaseolus vulgaris |
Repeat Motif | (AT)5 |
Primer 1 | BMd-042.Forward: TCATAGAAGATTTGTGGAAGCA |
Primer 2 | BMd-042.Reverse: TGAGACACGTACGAGGCTGTAT |
Product Length | 149 |
Publication | [view all] |
Contact | Matthew Blair
|
Comment | Bng105/R common bean genomic clone |
References
External references for this genetic_marker
Database | Accession |
DB:genbank | AZ301511 |
Alignments
The following features are aligned
Publications
Year | Publication |
2003 | Blair MW, Pedraza F, Buendia HF, Gaitán-Solís E, Beebe SE, Gepts P, Tohme J. Development of a genome-wide anchored microsatellite map for common bean (Phaseolus vulgaris L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2003 Nov; 107(8):1362-74. |
2010 | Blair MW, Medina JI, Astudillo C, Rengifo J, Beebe SE, Machado G, Graham R. QTL for seed iron and zinc concentration and content in a Mesoamerican common bean (Phaseolus vulgaris L.) population. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2010 Oct; 121(6):1059-70. |
|