BMd-0002

Marker Overview
NameBMd-0002
Genbank IDU18349
TypeSSR
SpeciesPhaseolus vulgaris
Repeat Motif(CGG)8
Primer 1BMd-0002.Forward: AGCGACAGCAAGAGAACCTC
Primer 2BMd-0002.Reverse: CAACAAACGGTGATTGACCA
Product Length106
Publication[view all]
ContactMatthew Blair
CommentPhaseolin G-box binding protein
References
External references for this genetic_marker
DatabaseAccession
DB:genbankU18349
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ForwardBMd-0002.ForwardPhaseolus vulgarisprimer
ReverseBMd-0002.ReversePhaseolus vulgarisprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BMd2BMd2-75.4Phaseolus vulgarismarker_locus
BMd002BMd002-7.12Phaseolus vulgarismarker_locus
BMd002BMd002-9.12Phaseolus vulgarismarker_locus
BMd002BMd002-7.72Phaseolus vulgarismarker_locus
BMd002BMd002-126.6Phaseolus vulgarismarker_locus
BMd2BMd2Phaseolus vulgarismarker_locus


Contact
NameDetails
Matthew Blair
First name:Matthew
Last name:Blair
Institution:International Center for Tropical Agriculture
Country:Colombia
Email:mwblaircgiar@gmail.com
Last update:Aug 2009
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Bean-DOR364/G19833-RIL-2010LG02N/A75.4BMd2View
2Bean-Beluga/PHA0399-RILLG02N/A7.12BMd002View
3Bean-Gonzalez_consensus_map-2016LG02N/A9.12BMd002View
4Bean-PHA0419/Beluga-RILLG02N/A7.72BMd002View
5Bean-DOR364/G19833-RIL-2008LG02N/A126.6BMd002View
6Bean-CAL143/IAC-UNA-RILLG02-1N/A46.8BMd2View
7Vigna-JP235863/AusTRCF66514-F2LG10N/A0BMd2View