BMd-0009

Name	BMd-0009
Genbank ID	X06336
Type	SSR
Species	Phaseolus vulgaris
Repeat Motif	(CATG)4
Primer 1	BMd-0009.Forward: TATGACACCACTGGCCATACA
Primer 2	BMd-0009.Reverse: CACTGCGACATGAGAGAAAGA
Product Length	135
Publication	[view all]
Contact	Matthew Blair
Comment	Phytohemagglutinin-L (PHA-L)

Name	Details
Matthew Blair	First name: Matthew Last name: Blair Institution: International Center for Tropical Agriculture Country: Colombia Email: mwblaircgiar@gmail.com Last update: Aug 2009

Database	Accession
DB:genbank	X06336

Aligned Feature	Feature Type	Alignment Location
Chr04	supercontig	Chr04:46268404..46268539 .
Chr04_WLD	supercontig	Chr04_WLD:47378325..47378457 .

Year	Publication
2010	Córdoba JM, Chavarro C, Schlueter JA, Jackson SA, Blair MW. Integration of physical and genetic maps of common bean through BAC-derived microsatellite markers. BMC genomics. 2010 Jul 16; 11:436.
2003	Blair MW, Pedraza F, Buendia HF, Gaitán-Solís E, Beebe SE, Gepts P, Tohme J. Development of a genome-wide anchored microsatellite map for common bean (Phaseolus vulgaris L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2003 Nov; 107(8):1362-74.

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Bean-DOR364/G19833-RIL-2010	LG04	N/A	8	BMd9	View
2	Bean-Beluga/PHA0399-RIL	LG04	N/A	110.25	BMd009	View
3	Bean-PHA0419/Beluga-RIL	LG04	N/A	111.46	BMd009	View
4	Bean-Cerinza/G10022-BC2	LG04	N/A	20.7	BMd9	View
5	Bean-Cerinza/G10022-BC2-2012	LG04	N/A	18	BMd9	View
6	Bean-DOR364/G19833-RIL-2008	LG04	N/A	24.9	BMd009	View
7	Bean-CAL143/IAC-UNA-RIL	LG04-1	N/A	29.5	BMd9	View
8	Bean-Tiber/Starozagorski-Integrated	LG04	N/A	37.08	BMd9	View
9	Bean-AND277/Milenio-BC2F3	LG04	N/A	232.53	SSR_BMd9	View