BMd-0020

Name	BMd-0020
Genbank ID	X74919
Type	SSR
Species	Phaseolus vulgaris
Repeat Motif	(TA)5
Primer 1	BMd-0020.Forward: GTTGCCACCGGTGATAATCT
Primer 2	BMd-0020.Reverse: GTGAGGCAAGAAGCCTTCAA
Product Length	123
Publication	[view all]
Contact	Matthew Blair
Comment	Endochitinase

Name	Details
Matthew Blair	First name: Matthew Last name: Blair Institution: International Center for Tropical Agriculture Country: Colombia Email: mwblaircgiar@gmail.com Last update: Aug 2009

Database	Accession
DB:genbank	X74919

Aligned Feature	Feature Type	Alignment Location
Chr05	supercontig	Chr05:38501105..38501226 .

Year	Publication
2010	Córdoba JM, Chavarro C, Schlueter JA, Jackson SA, Blair MW. Integration of physical and genetic maps of common bean through BAC-derived microsatellite markers. BMC genomics. 2010 Jul 16; 11:436.
2003	Blair MW, Pedraza F, Buendia HF, Gaitán-Solís E, Beebe SE, Gepts P, Tohme J. Development of a genome-wide anchored microsatellite map for common bean (Phaseolus vulgaris L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2003 Nov; 107(8):1362-74.

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Bean-DOR364/G19833-RIL-2010	LG05	N/A	94.3	BMd20	View
2	Bean-Beluga/PHA0399-RIL	LG05	N/A	55.47	BMd020	View
3	Bean-Gonzalez_consensus_map-2016	LG05	N/A	68.2	BMd020	View
4	Bean-PHA0419/Beluga-RIL	LG05	N/A	85.8	BMd020	View
5	Bean-Cerinza/G10022-BC2	LG05	N/A	22.8	BMd20	View
6	Bean-Cerinza/G10022-BC2-2012	LG05	N/A	21.9	BMd20	View
7	Bean-DOR364/G19833-RIL-2008	LG05	N/A	136.4	BMd020	View
8	Bean-CAL143/IAC-UNA-RIL	LG05	N/A	59.9	BMd20	View
9	Bean-Tiber/Starozagorski-Integrated	LG05	N/A	65.51	BMd20	View