|
|
Marker Overview
| Name | BMd-0022 |
|---|
| Genbank ID | X74403 |
|---|
| Type | SSR |
|---|
| Species | Phaseolus vulgaris |
|---|
| Repeat Motif | (TC)6 |
|---|
| Primer 1 | BMd-0022.Forward: GGTCACTTCCGGAGCATTC |
|---|
| Primer 2 | BMd-0022.Reverse: CGGGAAATGGAAGTCACAGT |
|---|
| Product Length | 121 |
|---|
| Publication | [view all] |
|---|
| Contact | Matthew Blair
|
|---|
| Comment | Cyclophilin |
|---|
References
External references for this genetic_marker
| Database | Accession |
|---|
| DB:genbank | X74403 |
Publications
| Year | Publication |
|---|
| 2010 | Córdoba JM, Chavarro C, Schlueter JA, Jackson SA, Blair MW. Integration of physical and genetic maps of common bean through BAC-derived microsatellite markers. BMC genomics. 2010 Jul 16; 11:436. |
| 2003 | Blair MW, Pedraza F, Buendia HF, Gaitán-Solís E, Beebe SE, Gepts P, Tohme J. Development of a genome-wide anchored microsatellite map for common bean (Phaseolus vulgaris L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2003 Nov; 107(8):1362-74. |
|
