BMd-0033

Name	BMd-0033
Genbank ID	AZ301561
Type	SSR
Species	Phaseolus vulgaris
Repeat Motif	(ATT)9
Primer 1	BMd-0033.Forward: TACGCTGTGATGCATGGTTT
Primer 2	BMd-0033.Reverse: CCTGAAAGTGCAGAGTGGTG
Product Length	110
Publication	[view all]
Contact	Matthew Blair
Comment	Bng91/R common bean genomic clone

Name	Details
Matthew Blair	First name: Matthew Last name: Blair Institution: International Center for Tropical Agriculture Country: Colombia Email: mwblaircgiar@gmail.com Last update: Aug 2009

Database	Accession
DB:genbank	AZ301561

Aligned Feature	Feature Type	Alignment Location
Chr11	supercontig	Chr11:3646697..3646804 .

Year	Publication
2010	Córdoba JM, Chavarro C, Schlueter JA, Jackson SA, Blair MW. Integration of physical and genetic maps of common bean through BAC-derived microsatellite markers. BMC genomics. 2010 Jul 16; 11:436.
2003	Blair MW, Pedraza F, Buendia HF, Gaitán-Solís E, Beebe SE, Gepts P, Tohme J. Development of a genome-wide anchored microsatellite map for common bean (Phaseolus vulgaris L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2003 Nov; 107(8):1362-74.

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Bean-DOR364/G19833-RIL-2010	LG11	N/A	16.8	BMd33	View
2	Bean-PMB0225/PHA1037-RIL	LG11	N/A	26.7	BMd33	View
3	Bean-Beluga/PHA0399-RIL	LG11	N/A	6.48	BMd033	View
4	Bean-Gonzalez_consensus_map-2016	LG11	N/A	28.21	BMd033	View
5	Bean-PHA0419/Beluga-RIL	LG11	N/A	33.86	BMd033	View
6	Bean-PMB0225/PHA1037-RIL-2015	LG11	N/A	34.1	BMd33	View
7	Bean-Cerinza/G10022-BC2	LG11	N/A	28.7	BMd33	View
8	Bean-Cerinza/G10022-BC2-2012	LG11	N/A	29.9	BMd33	View
9	Bean-DOR364/G19833-RIL-2008	LG11	N/A	108.2	BMd033	View
10	Bean-Tiber/Starozagorski-Integrated	LG11	N/A	26.96	BMd33	View