BMarc-0001

Name	BMarc-0001
Genbank ID	N/A
Type	SSR
Species	Phaseolus vulgaris
Repeat Motif	(CT)5
Primer 1	BMarc-0001.Forward: GCTAGCGCTTCTCTTATTCA
Primer 2	BMarc-0001.Reverse: AAGAAAAACCCTACCTTTGG
Product Length	162
Publication	[view all]
Contact	Matthew Blair

Name	Details
Matthew Blair	First name: Matthew Last name: Blair Institution: International Center for Tropical Agriculture Country: Colombia Email: mwblaircgiar@gmail.com Last update: Aug 2009

Year	Publication
2010	Blair MW, Muñoz C, Buendía HF, Flower J, Bueno JM, Cardona C. Genetic mapping of microsatellite markers around the arcelin bruchid resistance locus in common bean. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2010 Jul; 121(2):393-402.