SSR-IAC286

Marker Overview
NameSSR-IAC286
AliasIAC286
Genbank IDFJ809032
TypeSSR
SpeciesPhaseolus vulgaris
Repeat Motif(TC)18
Primer 1SSR-IAC286.Forward: TTGTTCTGAGGACTGGATGTAT
Primer 2SSR-IAC286.Reverse: TCGGTTGATTTTTCGTTTTA
Product Length181
Publication[view all]
ContactRafael Lozano
Anete deSouza
References
External references for this genetic_marker
DatabaseAccession
DB:genbankFJ809032
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ReverseSSR-IAC286.ReversePhaseolus vulgarisprimer
ForwardSSR-IAC286.ForwardPhaseolus vulgarisprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Anthracnose severity - leafqANSL.PMB0225/PHA1037.LG05.race:23Phaseolus vulgarisQTL
Anthracnose disease score - leafqANDL.PMB0225/PHA1037.LG05.race:23Phaseolus vulgarisQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
IAC286IAC286Phaseolus vulgarismarker_locus
IAC286IAC286-35.9Phaseolus vulgarismarker_locus
IAC286IAC286-30.2Phaseolus vulgarismarker_locus


Contact
NameDetails
Rafael Lozano
First name:Rafael
Last name:Lozano
Institution:Centro de Investigacion en Biotecnologia Agroalimentaria
Country:Spain
Email:rlozano@ual.es
Last update:Aug 2012
Anete deSouza
First name:Anete
Last name:deSouza
Institution:Universidade Estadual de Campinas
Country:Brazil
Email:anete@unicamp.br
Last update:Apr 2010
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Bean-CAL143/IAC-UNA-RILLG05N/A139.9IAC286View
2Bean-PMB0225/PHA1037-RIL-2015LG05N/A35.9IAC286-35.9View
3Bean-PMB0225/PHA1037-RILLG05N/A30.2IAC286-30.2View