|
Marker Overview
Name | BMd-0002 |
Genbank ID | U18349 |
Type | SSR |
Species | Phaseolus vulgaris |
Repeat Motif | (CGG)8 |
Primer 1 | BMd-0002.Forward: AGCGACAGCAAGAGAACCTC |
Primer 2 | BMd-0002.Reverse: CAACAAACGGTGATTGACCA |
Product Length | 106 |
Publication | [view all] |
Contact | Matthew Blair
|
Comment | Phaseolin G-box binding protein |
References
External references for this genetic_marker
Database | Accession |
DB:genbank | U18349 |
Alignments
The following features are aligned
Publications
Year | Publication |
2010 | Córdoba JM, Chavarro C, Schlueter JA, Jackson SA, Blair MW. Integration of physical and genetic maps of common bean through BAC-derived microsatellite markers. BMC genomics. 2010 Jul 16; 11:436. |
2003 | Blair MW, Pedraza F, Buendia HF, Gaitán-Solís E, Beebe SE, Gepts P, Tohme J. Development of a genome-wide anchored microsatellite map for common bean (Phaseolus vulgaris L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2003 Nov; 107(8):1362-74. |
|