DR749498

EST Overview
NameDR749498
Unique NameDR749498
TypeEST
OrganismCicer arietinum (chickpea)
Sequence length376
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
Cicer arietinum unigene v12010-12-27
Unigenes
This EST is part of the following unigenes:
Unigene NameAnalysis NameSequence type in Unigene
Cicer arietinum unigene v1Cicer arietinum unigene v1EST
Properties
Property NameValue
Singlet in analysisCicer arietinum unigene v1
Sequences
The following sequences are available for this feature:

EST sequence

>DR749498 ID=DR749498|Name=DR749498|organism=Cicer arietinum|type=EST|length=376bp
AAAGAGAGTTTAGAGTTTTTAGACTCAAAAGTCCTTACTGTTGCAAATTC
TCACTACAAGAAAGGGATAAATGTCATGGAGGATGTCTCGGCTGCTGAAA
GCTCAAATGCCTCTCTTAAGCCAAAACCTCTCACCATCTTTTATCGTGAA
AAGCCTGATGCATCCAGCAACAATCAGAAATCGATCACGGTCCCAACTAC
TTTCGAGTATAAAAGTTCCAAAGCAGTGCCTTGGAATTATGAGTGCAAGG
TAACTGTCGGGCAAGCAGTATCATCTCTTTCACTCTCAGTTGATAATATC
ATCGGAGTAGGAGGTTTGACACGAACTGGGAGATGTTATACACCAGATAG
CTTGCTTAAGCATGTGAACGGGCCTC
back to top