FD449552

EST Overview
NameFD449552
Unique NameFD449552
TypeEST
OrganismCicer arietinum (chickpea)
Sequence length228
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
Cicer arietinum unigene v12010-12-27
Libraries
Library NameType
LIBEST_022499 Chickpea Ascochyta-Induced Librarycdna_library
Unigenes
This EST is part of the following unigenes:
Unigene NameAnalysis NameSequence type in Unigene
Cicer arietinum unigene v1Cicer arietinum unigene v1EST
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Cicer_arietinum_v1_Contig1855contigCicer_arietinum_v1_Contig1855:13..240 +
Sequences
The following sequences are available for this feature:

EST sequence

>FD449552 ID=FD449552|Name=FD449552|organism=Cicer arietinum|type=EST|length=228bp
CTCACACTATGAAAGACACCGGAAAGAGCCATAAGGCGAACGGAAAATCT
TCGCCGGAGACAAGGAAGGATCGGAAATCAGCGACAGGAACGAGCGGATC
GCCGAAGAAAGGAGGACACGGAGGTAAGTTTACGTGGATCGGACGTGGCT
ACGAGGATCTTCAAATTGGACCTGATTACGGAGCATTGGATTCCAAGGAT
CCGAACTTCGAAGATCGTGAAGAAATCG
back to top
Relationships

This EST is a part of the following contig feature(s):

Feature NameUnique NameSpeciesType
Cicer_arietinum_v1_Contig1855Cicer_arietinum_v1_Contig1855Cicer arietinumcontig