CaSTMS21, CaSTMS21 (genetic_marker) Cicer arietinum

Marker Overview
NameCaSTMS21
AliasSTMS21
STMS21y
STMS21x
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(CT)9ATCT(CTTT)2(CT)4
Primer 1CaSTMS21.Forward primer: CTACAGTCTTTTGTTCTTCTAGCTT
Primer 2CaSTMS21.Reverse primer: ATATTTTTTAAGAGGCTTTTGGTAG
Product Length174
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerCaSTMS21.Forward primerCicer arietinumprimer
Reverse primerCaSTMS21.Reverse primerCicer arietinumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
100-seed weightqSDWT.ICC3996xS95362.LG1.HCicer arietinumQTL
100-seed weightqSDWT.ICC3996xS95362.LG1.WCicer arietinumQTL
Seed diameterqSDDIA.ICC3996xS95362.LG1.HCicer arietinumQTL
Seed diameterqSDDIA.ICC3996xS95362.LG1.WCicer arietinumQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Seed yield per plantqSYPL.VijayxICC4958.LG1a.PCicer arietinumQTL
100-seed weightqSDWT.VijayxICC4958.LG1a.I.5Cicer arietinumQTL
Days to maturityqDM.ILC588xILC3279.LG3.TH-cont09.2Cicer arietinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CaSTMS21CaSTMS21Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-ILC588xILC3279-RILLG3N/A100CaSTMS21View
2chickpea-JG62xVijay-VijayxICC4958-RILLG2N/A53.6CaSTMS21View
3chickpea-JG62xVijay-VijayxICC4958-RILLG5N/A65.9CaSTMS21View
4chickpea-VijayxICC4958-RIL-2011LG1aN/A89.9CaSTMS21View
5chickpea-VijayxICC4958-RIL-2011LG3N/A93.2CaSTMS21View
6chickpea-ICC4958xPI489777-RIL-2011LG1N/A0CaSTMS21View
7chickpea-ICC4958xPI489777-RIL-F10LG1N/A81.57CaSTMS21View
8chickpea-HadasxICC5810-RILLG1N/A41.9CaSTMS21View
9chickpea-ICC4958xPI489777-RIL-F10-2012LG01N/A16.57CaSTMS21View
10chickpea-ICC12004xLasseter-F2LGIVN/A58.4CaSTMS21View
11chickpea-ICC3996xILWC184-F2LG1N/A48.8CaSTMS21View
12chickpea-LasseterxICC3996-F6-RILLG1N/A24.3CaSTMS21View
13chickpea-S95362xHowzat-F6-RILLG1.1/5N/A26.4CaSTMS21View
14chickpea-ICC4958xPI489777-RIL-2010LG1N/A392CaSTMS21View