|
Marker Overview
Name | CaSTMS7 |
Genbank ID | N/A |
Type | STMS |
Species | Cicer arietinum |
Germplasm | ILC3279 |
Repeat Motif | (GA)12 |
Primer 1 | CaSTMS7.Forward primer: GAGGATTCGGATTCAGAT |
Primer 2 | CaSTMS7.Reverse primer: AAAATCTTGGAAGTGATTGAG |
Product Length | 161 |
Publication | [view all] |
Publications
Year | Publication |
1999 | Huttel B, Winter P, Weising K, Choumane W, Weigand F, Kahl G. Sequence-tagged microsatellite site markers for chickpea (Cicer arietinum L.). Genome. 1999; 42:210-217. |
2000 | Winter P, Benko-Iseppon A, Huttel B, Ratnaparkhe M, Tullu A, Sonnante G, Pfaff T, Tekeoglu M, Santra D, Sant V. A linkage map of the chickpea (Cicer arietinum L.) genome based on recombinant inbred lines from a C. arietinum x C. reticulatum cross: localization of resistance genes for fusarium wilt races 4 and 5. Theoretical and applied genetics. 2000 Nov; 101(7):1155-1163. |
|