|
|
Marker Overview
| Name | NCPGR12 |
|---|
| Genbank ID | AY255886 |
|---|
| Type | STMS |
|---|
| Species | Cicer arietinum |
|---|
| Germplasm | Pusa362 |
|---|
| Repeat Motif | (CT)35 |
|---|
| Primer 1 | NCPGR12.Forward primer: CCTTGTTAGTGTGTATAGGT |
|---|
| Primer 2 | NCPGR12.Reverse primer: GTAATGACCAAGTGAACA |
|---|
| Product Length | 251 |
|---|
| Publication | [view all] |
|---|
| Contact | Vincent Vadez
|
|---|
References
External references for this genetic_marker
| Database | Accession |
|---|
| DB:genbank | AY255886 |
Publications
| Year | Publication |
|---|
| 2003 | Sethy NK, Shokeen B, Bhatia S. Isolation and characterization of sequence-tagged microsatellite markers in chickpea (Cicer arietinum L.). Molecular Ecology Notes. 2003; 3:428-430. |
| 2018 | Sivasakthi K, Thudi M, Tharanya M, Kale SM, Kholová J, Halime MH, Jaganathan D, Baddam R, Thirunalasundari T, Gaur PM, Varshney RK, Vadez V. Plant vigour QTLs co-map with an earlier reported QTL hotspot for drought tolerance while water saving QTLs map in other regions of the chickpea genome. BMC plant biology. 2018 Feb 06; 18(1):29. |
|
