PIP151, PIP151 (genetic_marker) Cicer sp. | PulseDB

Marker Overview

Marker Overview


Name	PIP151
Genbank ID	JK313506
Type	EST marker
Species	Cicer sp.
Primer 1	PIP151.Forward primer: CGGTACCATCCGTAAAAACG
Primer 2	PIP151.Reverse primer: ACTTAGCATGACCGTGCTTG
Product Length	300
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	JK313506

Publications


Year	Publication
2012	Choudhary S, Gaur R, Gupta S. EST-derived genic molecular markers: development and utilization for generating an advanced transcript map of chickpea. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2012 May; 124(8):1449-62.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Chickpea_SBD377_X_BGD112_RIL	LG1	N/A	71.2	PIP151	View
2	Chickpea-SBD377/BGD112-RIL-High_density	LG01	N/A	86.66	PIP151	View