TA176, TA176 (genetic_marker) Cicer arietinum

Marker Overview
NameTA176
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(TAA)40(GAA)9
Primer 1TA176.Forward primer: ATTTGGCTTAAACCCTCTTC
Primer 2TA176.Reverse primer: TTTATGCTTCCTCTTCTTCG
Product Length233
Publication[view all]
Comment17984
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
TA176.Forward primerTA176.Forward primerCicer arietinumprimer
TA176.Reverse primerTA176.Reverse primerCicer arietinumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
100-seed weightqSDWT.ILC3279xICCV2.LG4Cicer arietinumQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Plant widthqPLWTH.VijayxICC4958.LG4.IV.2Cicer arietinumQTL
Number of branches per plantqBPL.VijayxICC4958.LG4.IVCicer arietinumQTL
Ascochyta blight resistanceqABR.ICCV96029xCDCFrontier.LG6Cicer arietinumQTL
Canopy temperature differentialqCTEMP.ILC588xILC3279.LG6.TH06.9WASCicer arietinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TA176TA176Cicer arietinummarker_locus
TA176TA176-35.31Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-ICC4991xICCV04516-F2LG6N/A37TA176View
2chickpea-ICCV2xJG62-F10-RILLG6AN/A39TA176View
3chickpea-ICCV2xJG62-RILLG3N/A96TA176View
4chickpea-ICCV96029xAmit-F2LG6N/A42.7TA176View
5chickpea-ICCV96029xCDCCorinne-F2LG6N/A51.7TA176View
6chickpea-ICCV96029xCDCFrontier-F2LG6N/A140.3TA176View
7chickpea-ICCV96029xCDCLuna-F2LG6N/A37.5TA176View
8chickpea-ILC3279xICCV2-F3LG4N/A22.4TA176View
9chickpea-JG62xVijay-RIL-2011LG4N/A38.4TA176View
10chickpea-JG62xVijay-VijayxICC4958-RILLG4N/A42.2TA176View
11chickpea-VijayxICC4958-RIL-2011LG4N/A18.5TA176View
12chickpea-ICC4958xPI489777-RIL-2012LG6N/A192.1TA176View
13chickpea-ICCV2xJG62-RIL-F10-2011LGVIN/A45.9TA176View
14chickpea-ICC4958xPI489777-RIL-2012-2LG6N/A26.9TA176View
15chickpea-ICC4958xPI489777-RIL-F10LG6N/A91.24TA176View
16chickpea-ICCV96029xCDCFrontier-F2-2007LG6N/A140.3TA176View
17chickpea-HadasxCr205-F2LG6BN/A26.4TA176View
18chickpea-ICC4958xPI489777-RIL-F10-2012LG06N/A53.71TA176View
19chickpea-ICC12004xLasseter-F2LGVN/A18.8TA176View
20chickpea-ICC3996xILWC184-F2LG6N/A46.7TA176View
21chickpea-ILC588xILC3279-RIL-F6LG6N/A1.3TA176View
22chickpea-ICC4958xPI489777-RIL-2015-2LG6N/A79.87TA176View
23Chickpea-RIP-1_x_RIP-1-RIL-geneticLG6N/A20.8TA176View
24Chickpea-CPR-01_x_CRP-01-RIL-physicalLG6N/A48041944TA176View
25chickpea-ICCV96029×CDCFrontier-F2-2017CaLG06N/A28.6TA176View
26chickpea-ICC5810×CDCFrontier-F2-2017CaLG06N/A29.3TA176View
27chickpea-ICC16641×CDCFrontier-F2-2017CaLG06N/A27.9TA176View
28chickpea-flowering_time_consensus_map-F2-2017CaLG06N/A30.4TA176View
29Chickpea_SBD377_X_BGD112_RILLG6N/A106.7TA176View
30Chickpea-RIP5-OrtegaLG06N/A2.3TA176View
31Chickpea-SBD377/BGD112-RIL-High_densityLG06N/A79.48TA176View
32Chickpea-ICC4958/PI489777-RIL-2020LG06N/A177.19TA176View
33Chickpea-JG62/ICCV05530-RILLG06N/A35.31TA176View