TA59, TA59 (genetic_marker) Cicer arietinum

Name	TA59
Genbank ID	N/A
Type	STMS
Species	Cicer arietinum
Germplasm	ILC3279
Repeat Motif	(TAA)29
Primer 1	TA59.Forward primer: ATCTAAAGAGAAATCAAAATTGTCGAA
Primer 2	TA59.Reverse primer: GCAAATGTGAAGCATGTATAGATAAAG
Product Length	258
Publication	[view all]

This genetic_marker is adjacent to the following primer feature(s):

Feature Name	Unique Name	Species	Type
TA59.Forward primer	TA59.Forward primer	Cicer arietinum	primer
TA59.Reverse primer	TA59.Reverse primer	Cicer arietinum	primer

This genetic_marker is located in the following QTL feature(s):

Feature Name	Unique Name	Species	Type
Plant width	qPLWTH.JG62xVijay.LG5.P.2	Cicer arietinum	QTL

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature Name	Unique Name	Species	Type
TA59	TA59	Cicer arietinum	marker_locus
TA59	TA59-15.74	Cicer arietinum	marker_locus

Year	Publication
1999	Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101.
2007	Radhika P, Gowda SJM, Kadoo NY, Mhase LB, Jamadagni BM, Sainani MN, Chandra S, Gupta VS. Development of an integrated intraspecific map of chickpea (Cicer arietinum L.) using two recombinant inbred line populations. Theoretical and applied genetics TAG. 2007; 115(2):209-216.
2014	Patil B, Ravikumar R, Bhat J, Soregaon C. Molecular mapping of QTLs for resistance to early and late Fusarium wilt in chickpea. Czech journal of genetics and plant breeding. 2014; 50(2):171-176.
2015	Gupta S, Kumar T, Verma S, Bharadwaj C, Bhatia S. Development of gene-based markers for use in construction of the chickpea (Cicer arietinum L.) genetic linkage map and identification of QTLs associated with seed weight and plant height. 2015 Oct 7.

Stock Name	Type
ILC3279	breeding_research_material

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4991xICCV04516-F2	LG2	N/A	41.7	TA59	View
2	chickpea-ICCV2xJG62-RIL	LG2	N/A	5.1	TA59	View
3	chickpea-ICCV96029xCDCFrontier-F2	LG2	N/A	49.1	TA59	View
4	chickpea-ICCV96029xCDCLuna-F2	LG2	N/A	15.2	TA59	View
5	chickpea-JG62xVijay-RIL-2011	LG5	N/A	44.8	TA59	View
6	chickpea-JG62xVijay-VijayxICC4958-RIL	LG3	N/A	21.1	TA59	View
7	chickpea-ICC4958xPI489777-RIL-2011	LG2	N/A	62.9	TA59	View
8	chickpea-ICC4958xPI489777-RIL-2012	LG2	N/A	66.6	TA59	View
9	chickpea-ICCV2xJG62-RIL-F10-2011	LGII	N/A	34.8	TA59	View
10	chickpea-ICC4958xPI489777-RIL-2012-2	LG2	N/A	58.4	TA59	View
11	chickpea-ICC4958xPI489777-RIL-F10	LG2	N/A	56.01	TA59	View
12	chickpea-ICCV96029xCDCFrontier-F2-2007	LG2	N/A	49.1	TA59	View
13	chickpea-HadasxCr205-F2	LG2B	N/A	36.2	TA59	View
14	chickpea-LasseterxPI527930-F2	LG2	N/A	48	TA59	View
15	chickpea-ILC3279xWR315-RIL-2007	LG2	N/A	29.5	TA59	View
16	chickpea-ICC4958xPI489777-RIL-F10-2012	LG02	N/A	47.97	TA59	View
17	chickpea-ICC3996xILWC184-F2	LG2	N/A	1	TA59	View
18	chickpea-LasseterxICC3996-F6-RIL	LG2.2	N/A	30.9	TA59	View
19	chickpea-ILC588xILC3279-RIL-F6	LG2	N/A	4.1	TA59	View
20	chickpea-ICC4958xPI489777-RIL-2010	LG2	N/A	120.1	TA59	View
21	chickpea-ICC4958xPI489777-RIL-2015-2	LG2	N/A	68.17	TA59	View
22	chickpea-ICCV96029×CDCFrontier-F2-2017	CaLG02	N/A	4.9	TA59	View
23	chickpea-ICC5810×CDCFrontier-F2-2017	CaLG02	N/A	29.2	TA59	View
24	chickpea-BGD132×CDCFrontier-F2-2017	CaLG02	N/A	3.3	TA59	View
25	chickpea-flowering_time_consensus_map-F2-2017	CaLG02	N/A	28.9	TA59	View
26	Chickpea-JG62xVijayxVijayxICC4958-RIL	LG3 (LGII+VIII)	N/A	21.1	TA59	View
27	Chickpea-ICCL81001_x_Cr5-9-RIL	LG2	N/A	46	TA59	View
28	Chickpea-JG62_X_WR315-RIL	LG2	N/A	14.3	TA59	View
29	Chickpea_SBD377_X_BGD112_RIL	LG2	N/A	23.6	TA59	View
30	Chickpea-RIP12-Ortega	LG02	N/A	9.5	TA59	View
31	Chickpea-RIP5-Ortega	LG02	N/A	14	TA59	View
32	Chickpea-RIP8-Ortega	LG02-1	N/A	12.4	TA59	View
33	Chickpea-SBD377/BGD112-RIL-High_density	LG01	N/A	95.9	TA59	View
34	Chickpea-JG62/ICCV05530-RIL	LG02	N/A	15.74	TA59-15.74	View