TA59, TA59 (genetic_marker) Cicer arietinum

Marker Overview
NameTA59
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(TAA)29
Primer 1TA59.Forward primer: ATCTAAAGAGAAATCAAAATTGTCGAA
Primer 2TA59.Reverse primer: GCAAATGTGAAGCATGTATAGATAAAG
Product Length258
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
TA59.Forward primerTA59.Forward primerCicer arietinumprimer
TA59.Reverse primerTA59.Reverse primerCicer arietinumprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Plant widthqPLWTH.JG62xVijay.LG5.P.2Cicer arietinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TA59TA59Cicer arietinummarker_locus
TA59TA59-15.74Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-ICC4991xICCV04516-F2LG2N/A41.7TA59View
2chickpea-ICCV2xJG62-RILLG2N/A5.1TA59View
3chickpea-ICCV96029xCDCFrontier-F2LG2N/A49.1TA59View
4chickpea-ICCV96029xCDCLuna-F2LG2N/A15.2TA59View
5chickpea-JG62xVijay-RIL-2011LG5N/A44.8TA59View
6chickpea-JG62xVijay-VijayxICC4958-RILLG3N/A21.1TA59View
7chickpea-ICC4958xPI489777-RIL-2011LG2N/A62.9TA59View
8chickpea-ICC4958xPI489777-RIL-2012LG2N/A66.6TA59View
9chickpea-ICCV2xJG62-RIL-F10-2011LGIIN/A34.8TA59View
10chickpea-ICC4958xPI489777-RIL-2012-2LG2N/A58.4TA59View
11chickpea-ICC4958xPI489777-RIL-F10LG2N/A56.01TA59View
12chickpea-ICCV96029xCDCFrontier-F2-2007LG2N/A49.1TA59View
13chickpea-HadasxCr205-F2LG2BN/A36.2TA59View
14chickpea-LasseterxPI527930-F2LG2N/A48TA59View
15chickpea-ILC3279xWR315-RIL-2007LG2N/A29.5TA59View
16chickpea-ICC4958xPI489777-RIL-F10-2012LG02N/A47.97TA59View
17chickpea-ICC3996xILWC184-F2LG2N/A1TA59View
18chickpea-LasseterxICC3996-F6-RILLG2.2N/A30.9TA59View
19chickpea-ILC588xILC3279-RIL-F6LG2N/A4.1TA59View
20chickpea-ICC4958xPI489777-RIL-2010LG2N/A120.1TA59View
21chickpea-ICC4958xPI489777-RIL-2015-2LG2N/A68.17TA59View
22chickpea-ICCV96029×CDCFrontier-F2-2017CaLG02N/A4.9TA59View
23chickpea-ICC5810×CDCFrontier-F2-2017CaLG02N/A29.2TA59View
24chickpea-BGD132×CDCFrontier-F2-2017CaLG02N/A3.3TA59View
25chickpea-flowering_time_consensus_map-F2-2017CaLG02N/A28.9TA59View
26Chickpea-JG62xVijayxVijayxICC4958-RILLG3 (LGII+VIII)N/A21.1TA59View
27Chickpea-ICCL81001_x_Cr5-9-RILLG2N/A46TA59View
28Chickpea-JG62_X_WR315-RILLG2N/A14.3TA59View
29Chickpea_SBD377_X_BGD112_RILLG2N/A23.6TA59View
30Chickpea-RIP12-OrtegaLG02N/A9.5TA59View
31Chickpea-RIP5-OrtegaLG02N/A14TA59View
32Chickpea-RIP8-OrtegaLG02-1N/A12.4TA59View
33Chickpea-SBD377/BGD112-RIL-High_densityLG01N/A95.9TA59View
34Chickpea-JG62/ICCV05530-RILLG02N/A15.74TA59-15.74View