TR29, TR29 (genetic_marker) Cicer arietinum

Marker Overview
NameTR29
AliasTR29s
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(TAA)8TAGTAATAG(TAA)32
Primer 1TR29.Forward primer: GCCCACTGAAAAATAAAAAG
Primer 2TR29.Reverse primer: ATTTGAACCTCAAGTTCTCG
Product Length220
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
TR29.Forward primerTR29.Forward primerCicer arietinumprimer
TR29.Reverse primerTR29.Reverse primerCicer arietinumprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Pod number per plantqPDPL.JG62xVijay.LG2.III.3Cicer arietinumQTL
Seed yield per plantqSYPL.JG62xVijay.LG2.II.2Cicer arietinumQTL
Plant widthqPLWTH.VijayxICC4958.LG2.ICicer arietinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TR29TR29Cicer arietinummarker_locus
TR29TR29-25.8Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-ICC4991xICCV04516-F2LG5BN/A33.9TR29View
2chickpea-ICCV2xJG62-RILLG7N/A1.7TR29View
3chickpea-ICCV96029xCDCFrontier-F2LG5N/A99.8TR29View
4chickpea-ICCV96029xCDCLuna-F2LG5N/A55.5TR29View
5chickpea-ILC3279xICCV2-F3LG5N/A36.7TR29View
6chickpea-JG62xVijay-RIL-2011LG2N/A88.6TR29View
7chickpea-JG62xVijay-VijayxICC4958-RILLG1N/A38.6TR29View
8chickpea-VijayxICC4958-RIL-2011LG2N/A72.9TR29View
9chickpea-ICC4958xPI489777-RIL-2012LG5N/A217.1TR29View
10chickpea-ICC4958xPI489777-RIL-2012-2LG5N/A55.2TR29View
11chickpea-ICC4958xPI489777-RIL-F10LG5N/A95.53TR29View
12chickpea-ICCV96029xCDCFrontier-F2-2007LG5N/A99.8TR29View
13chickpea-HadasxCr205-F2LG5B-2N/A3.7TR29View
14chickpea-LasseterxPI527930-F2LG5N/A39.3TR29View
15chickpea-ICC4958xPI489777-RIL-F10-2012LG05N/A87.17TR29View
16chickpea-ICC12004xLasseter-F2LGVIIN/A0TR29View
17chickpea-ICC4958xPI489777-RIL-2010LG5N/A175.8TR29View
18chickpea-ICC4958xPI489777-RIL-2015-2LG5N/A40.49TR29View
19Chickpea-JG62xVijayxVijayxICC4958-RILLG1 (LGIII+V+XIII)N/A38.6TR29View
20chickpea-ICCV96029×CDCFrontier-F2-2017CaLG05N/A1.7TR29View
21chickpea-BGD132×CDCFrontier-F2-2017CaLG05N/A0TR29View
22chickpea-flowering_time_consensus_map-F2-2017CaLG05N/A6.5TR29View
23Chickpea-CA2156_x_JG62-RILRIP-1 LG5N/A25TR29View
24Chickpea-ILC3279_x_JG62-RILRIP-7 LG5N/A0TR29View
25Chickpea-JG62_x_ILC72-RILRIP-10 LG5N/A11TR29View
26Chickpea-Physical_consensusCa5N/A7716634TR29View
27Chickpea-JG62_X_WR315-RILLG4N/A0TR29View
28Chickpea-ICC4958× ICC1882-RILCaLG05N/A23.47TR29View
29Chickpea_SBD377_X_BGD112_RILLG5N/A176.2TR29View
30Chickpea-SBD377/BGD112-RIL-High_densityLG05N/A88.61TR29View
31Chickpea-ICC4958/PI489777-RIL-2020LG05N/A172.32TR29View
32Chickpea-JG62/ICCV05530-RILLG05N/A25.8TR29-25.8View