TR40, TR40 (genetic_marker) Cicer arietinum

Name	TR40
Genbank ID	N/A
Type	STMS
Species	Cicer arietinum
Germplasm	ILC3279
Repeat Motif	(TAA)44
Primer 1	TR40.Forward primer: AAGTGAAATATGTCATCCTTATTACTAACT
Primer 2	TR40.Reverse primer: AGGAAACTGTGTTTCGTCTTTTTATT
Product Length	284
Publication	[view all]

Year	Publication
1999	Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101.
2007	Radhika P, Gowda SJM, Kadoo NY, Mhase LB, Jamadagni BM, Sainani MN, Chandra S, Gupta VS. Development of an integrated intraspecific map of chickpea (Cicer arietinum L.) using two recombinant inbred line populations. Theoretical and applied genetics TAG. 2007; 115(2):209-216.
2015	Gupta S, Kumar T, Verma S, Bharadwaj C, Bhatia S. Development of gene-based markers for use in construction of the chickpea (Cicer arietinum L.) genetic linkage map and identification of QTLs associated with seed weight and plant height. 2015 Oct 7.

Stock Name	Type
ILC3279	accession

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4991xICCV04516-F2	LG6	N/A	72.3	TR40	View
2	chickpea-ICCV2xJG62-F10-RIL	LG6A	N/A	60	TR40	View
3	chickpea-ICCV2xJG62-RIL	LG3	N/A	14.2	TR40	View
4	chickpea-ICCV96029xAmit-F2	LG4	N/A	58	TR40	View
5	chickpea-ICCV96029xAmit-F2	LG6	N/A	43.8	TR40	View
6	chickpea-ICCV96029xCDCCorinne-F2	LG4	N/A	10.1	TR40	View
7	chickpea-ICCV96029xCDCCorinne-F2	LG6	N/A	50.8	TR40	View
8	chickpea-ICCV96029xCDCFrontier-F2	LG4	N/A	127.9	TR40	View
9	chickpea-ICCV96029xCDCFrontier-F2	LG6	N/A	142.9	TR40	View
10	chickpea-ICCV96029xCDCLuna-F2	LG4	N/A	83.4	TR40	View
11	chickpea-ICCV96029xCDCLuna-F2	LG6	N/A	37.5	TR40	View
12	chickpea-JG62xVijay-RIL-2011	LG4	N/A	38.2	TR40	View
13	chickpea-JG62xVijay-VijayxICC4958-RIL	LG4	N/A	53.1	TR40	View
14	chickpea-ICCV96029xCDCFrontier-F2-2007	LG4	N/A	127.9	TR40	View
15	chickpea-ICCV96029xCDCFrontier-F2-2007	LG6	N/A	142.9	TR40	View
16	chickpea-HadasxCr205-F2	LG6B	N/A	41.6	TR40	View
17	chickpea-ICC3996xILWC184-F2	LG6	N/A	57	TR40	View
18	chickpea-ILC588xILC3279-RIL-F6	LG4	N/A	2.7	TR40	View
19	chickpea-ICCV96029×CDCFrontier-F2-2017	CaLG06	N/A	28.9	TR40	View
20	chickpea-BGD132×CDCFrontier-F2-2017	CaLG06	N/A	29.3	TR40	View
21	chickpea-flowering_time_consensus_map-F2-2017	CaLG06	N/A	29.3	TR40	View
22	Chickpea-JG62xVijayxVijayxICC4958-RIL	LG4 (LGVI)	N/A	53.1	TR40	View
23	Chickpea_SBD377_X_BGD112_RIL	LG6	N/A	73.9	TR40	View
24	Chickpea-SBD377/BGD112-RIL-High_density	LG06	N/A	56.96	TR40	View