TR59, TR59 (genetic_marker) Cicer arietinum

Marker Overview
NameTR59
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(TA)3(TAA)17T(TAA)4
Primer 1TR59.Forward primer: AAAAGGAACCTCAAGTGACA
Primer 2TR59.Reverse primer: GAAAATGAGGGAGTGAGATG
Product Length174
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
TR59.Forward primerTR59.Forward primerCicer arietinumprimer
TR59.Reverse primerTR59.Reverse primerCicer arietinumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
100-seed weightqSDWT.ICCV2xJG62.LG7.5LSCicer arietinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TR59TR59Cicer arietinummarker_locus
TR59TR59-20.01Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-C214xWR315-F2LG5N/A72.3TR59View
2chickpea-ICCV2xJG62-RILLG7N/A1.7TR59View
3chickpea-ICCV96029xCDCFrontier-F2LG5N/A42.5TR59View
4chickpea-JG62xVijay-RIL-2011LG2N/A83.4TR59View
5chickpea-JG62xVijay-VijayxICC4958-RILLG1N/A45.3TR59View
6chickpea-VijayxICC4958-RIL-2011LG2N/A37.4TR59View
7chickpea-ICC4958xPI489777-RIL-2012LG5N/A203.4TR59View
8chickpea-ICCV2xJG62-RIL-F10-2011LGVN/A16.3TR59View
9chickpea-ICC4958xPI489777-RIL-2012-2LG5N/A48TR59View
10chickpea-ICC4958xPI489777-RIL-F10LG5N/A87.3TR59View
11chickpea-ICCV96029xCDCFrontier-F2-2007LG5N/A42.5TR59View
12chickpea-HadasxCr205-F2LG5B-2N/A0.5TR59View
13chickpea-ICC3996xILWC184-F2LG5N/A11.1TR59View
14chickpea-ILC588xILC3279-RIL-F6LG5N/A1.3TR59View
15chickpea-ICC4958xPI489777-RIL-2010LG5N/A170.5TR59View
16chickpea-ICC4958xPI489777-RIL-2015-2LG5N/A47.46TR59View
17Chickpea-JG62xVijayxVijayxICC4958-RILLG1 (LGIII+V+XIII)N/A45.3TR59View
18chickpea-ICCV96029×CDCFrontier-F2-2017CaLG05N/A5.5TR59View
19chickpea-BGD132×CDCFrontier-F2-2017CaLG05N/A4.5TR59View
20chickpea-flowering_time_consensus_map-F2-2017CaLG05N/A2TR59View
21Chickpea-CA2156_x_JG62-RILRIP-1 LG5N/A12TR59View
22Chickpea-ILC3279_x_JG62-RILRIP-7 LG5N/A13.6TR59View
23Chickpea-JG62_x_ILC72-RILRIP-10 LG5N/A21.1TR59View
24Chickpea-ICCL81001_x_Cr5-9-RILLG5N/A105.3TR59View
25Chickpea_SBD377_X_BGD112_RILLG5N/A147.2TR59View
26Chickpea-RIP12-OrtegaLG05N/A5.2TR59View
27Chickpea-SBD377/BGD112-RIL-High_densityLG05N/A81.86TR59View
28Chickpea-ICC4958/PI489777-RIL-2020LG05N/A173.64TR59View
29Chickpea-JG62/ICCV05530-RILLG05N/A20.01TR59-20.01View