|
Marker Overview
Name | TS29 |
Genbank ID | N/A |
Type | STMS |
Species | Cicer arietinum |
Germplasm | ILC3279 |
Repeat Motif | (TAA)38 |
Primer 1 | TS29.Forward primer: AACATTCATGAACCTACCTCAACTTA |
Primer 2 | TS29.Reverse primer: CCATATATGAGTACACTACCTCTCGG |
Product Length | 342 |
Publication | [view all] |
Publications
Year | Publication |
1999 | Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101. |
2015 | Gupta S, Kumar T, Verma S, Bharadwaj C, Bhatia S. Development of gene-based markers for use in construction of the chickpea (Cicer arietinum L.) genetic linkage map and identification of QTLs associated with seed weight and plant height. 2015 Oct 7. |
|