TS5, TS5 (genetic_marker) Cicer arietinum

Marker Overview
NameTS5
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(TTA)35
Primer 1TS5.Forward primer: GTTGAATAGTACTTTCCCACTTGAGTC
Primer 2TS5.Reverse primer: TGAGACTAAAAATCATATATTCCCCC
Product Length231
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
TS5.Forward primerTS5.Forward primerCicer arietinumprimer
TS5.Reverse primerTS5.Reverse primerCicer arietinumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Plant heightqPLHGT.ILC3279xICCV2.LG3Cicer arietinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Ts5Ts5Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material