AB142, AB142 (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	AB142
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	AB142.Forward Primer: tgagagataaggatacacccattgag
Primer 2	AB142.Reverse Primer: cttcatatgaggtttctcagtgacga
Publication	[view all]
Comment	Agrogène; PSMPS prefix for marker

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
chr3LG5	supercontig	chr3LG5:317153186..317153368 .	Pisum sativum Cameor genome v1a	PCD marker alignment to genome using primer sequences

Publications


Year	Publication
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-consensusMap-2011	LGV	N/A	186.8	AB142	View
2	pea-PennantxPI595933-F2	LG3	N/A	149.5	AB142	View
3	pea-ShawneexBohatyr-RIL	LGVb.3	N/A	118.3	AB142-185	View
4	pea-microsatComposite-2005	LGV	N/A	161	AB142-185	View
5	Pea-Composite_Map-RIL	LGV	N/A	127.3	AB142-185	View
6	pea-DSPx90-2131-RIL-2015	LGV	N/A	106.5	PSAB142	View
7	Pea-Baccara/PI180693_Duarte-RIL-2016	LGV	N/A	98.8	AB142-185	View
8	Pea-Baccara/PI180693_GBS-RIL-2016	LGV	N/A	104.8	AB142-185	View