|
Marker Overview
Name | C5DNAmet |
Genbank ID | AF034419 |
Type | Indel |
Species | Pisum sativum |
Primer 1 | C5DNAmet.Forward Primer: TTCTTACTGTTCGTGAATGCGCC |
Primer 2 | C5DNAmet.Reverse Primer: GCCCTAATCCTCTAATTGGCGCTC |
Publication | [view all] |
References
External references for this genetic_marker
Database | Accession |
DB:genbank | AF034419 |
Alignments
The following features are aligned
Publications
Year | Publication |
2011 | Bordat A, Savois V, Nicolas M, Salse J, Chauveau A, Bourgeois M, Potier J, Houtin H, Rond C, Murat F, Marget P, Aubert G, Burstin J. Translational Genomics in Legumes Allowed Placing In Silico 5460 Unigenes on the Pea Functional Map and Identified Candidate Genes in Pisum sativum L. G3 (Bethesda, Md.). 2011 Jul; 1(2):93-103. |
2014 | Duarte J, Riviere N, Barabger A, Aubert G, Burstin J, Cornet L, Lavaud C, Lejeune-Henaut I, Martinant JP, Pichon JP, Pilet-Nayel ML, Boutet G. Transcriptome sequencing for high throughput SNP development and genetic mapping in Pea. BMC Genomics. 2014; 15:126. |
|