|
Marker Overview
Name | Pore |
Genbank ID | Z73553 |
Type | ASP |
Species | Pisum sativum |
Primer 1 | Pore.Primer 1: GCCTCGTAGCAGTTTTTCAGGG |
Primer 2 | Pore.Primer 2: CAAAGACAACGGAGACCAAGTG |
Primer 3 | Pore.Primer 3: CTGCAGATACCAGAGCCC |
Primer 4 | Pore.Primer 4: CGGAGGTGCAGTGACAGA |
Publication | [view all] |
References
External references for this genetic_marker
Database | Accession |
DB:genbank | Z73553 |
Publications
Year | Publication |
2006 | Aubert G, Morin J, Jacquin F, Loridon K, Quillet M, Petit A, Rameau C, Lejeune-Hénaut I, Huguet T, Burstin J. Functional mapping in pea, as an aid to the candidate gene selection and for investigating synteny with the model legume Medicago truncatula. Theoretical and applied genetics. 2006; 112(6):1024-1041. |
2016 | Ferrari B., Romani M., Aubert G., Boucherot K., Burstin J., Pecetti L., Huart-Naudet M., Klein A., Annicchiarico P. . Association of SNP Markers with Agronomic and Quality Traits of Field Pea in Italy. Czech Journal of Genetics and Plant Breeding. 2016; 52(3):83-93. |
|