PPIlike, PPIlike (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	PPIlike
Genbank ID	CD860684
Type	SSCP
Species	Pisum sativum
Primer 1	PPIlike.Forward Primer: hTTTTGAGCATGGCGAATG
Primer 2	PPIlike.Reverse Primer: GCTTGCTTGTCTCCTGTGATT
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	CD860684

Publications


Year	Publication
2006	Aubert G, Morin J, Jacquin F, Loridon K, Quillet M, Petit A, Rameau C, Lejeune-Hénaut I, Huguet T, Burstin J. Functional mapping in pea, as an aid to the candidate gene selection and for investigating synteny with the model legume Medicago truncatula. Theoretical and applied genetics. 2006; 112(6):1024-1041.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-compositeMap-2006	LGII	N/A	106.5	Ppllike	View
2	pea-consensusMap-2011	LGII	N/A	110.2	PPIlike	View
3	pea-TeresexChampagne-RIL-2009	LG2	N/A	100.2	PPIlike	View