|
|
Marker Overview
| Name | PsDof6 |
|---|
| Genbank ID | AB087851 |
|---|
| Type | dCAPS |
|---|
| Species | Pisum sativum |
|---|
| Primer 1 | PsDof6.Forward Primer: CCTCACTACACACGAATTCCGAG |
|---|
| Primer 2 | PsDof6.Reverse Primer: CACGACGTTGTAAAACGACCGGCAGCGTTAGATATCGGAGAG |
|---|
| Restriction Enzyme | KpnI |
|---|
| Publication | [view all] |
|---|
References
External references for this genetic_marker
| Database | Accession |
|---|
| DB:genbank | AB087851 |
Publications
| Year | Publication |
|---|
| 2011 | Bordat A, Savois V, Nicolas M, Salse J, Chauveau A, Bourgeois M, Potier J, Houtin H, Rond C, Murat F, Marget P, Aubert G, Burstin J. Translational Genomics in Legumes Allowed Placing In Silico 5460 Unigenes on the Pea Functional Map and Identified Candidate Genes in Pisum sativum L. G3 (Bethesda, Md.). 2011 Jul; 1(2):93-103. |
| 2015 | Sudheesh S, Rodda M, Kennedy P, Verma P, Leonforte A, Cogan NOI, Materne M, Forster JW, Kaur S. Construction of an integrated linkage map and trait dissection for bacterial blight resistance in field pea (Pisum sativum L.). 2015; 35:185. |
| 2014 | Klein A, Houtin H, Rond C, Marget P, Jacquin F, Boucherot K, Huart M, Riviere N, Boutet G, Lejeune-Henaut I, Burstin J. QTL analysis of frost damage in pea suggests different mechanisms involved in frost tolerance. Theoretical and Applied Genetics. 2014; 127(6):1319-1330. |
|
