SGR_SNP1, SGR_SNP1 (genetic_marker) Pisum sativum

Marker Overview
NameSGR_SNP1
AliasSGR
dbSNP IDN/A
TypeSNP
SNP AllelesN/A
5' Flanking SequenceTTCTCCTCAACAGAAACCATGTTTTCCGCATAGAAGACGGTTTGAGAATGGGAAGAAGAA
3' Flanking SequenceCAATCAATTGTTCCTGTATGTTTTTTCTGTTTTTTTCTCTCTTCAATTTTCCAACATAAA
SpeciesPisum sativum
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankAM884277-8
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SGRSGRPisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Lupin-83A:476/P27255-RIL-2017LG17N/A40.35SGRView
2pea-consensusMap-2011LGIN/A136.6SGRView
3Pea-Kaspa_x_Attika-RIL-2016LGIN/A108.5SGRView
4Pea-Kaspa_x_Isard-RIL-2016LGIN/A120.2SGRView
5Pea-Consensus_RIL-2016LGIN/A123.3SGRView
Sequence
>SGR_SNP1 ID=SGR_SNP1|Name=SGR_SNP1|organism=Pisum sativum|type=genetic_marker|length=121bp
TTCTCCTCAACAGAAACCATGTTTTCCGCATAGAAGACGGTTTGAGAATG
GGAAGAAGAAWCAATCAATTGTTCCTGTATGTTTTTTCTGTTTTTTTCTC
TCTTCAATTTTCCAACATAAA