|
|
Marker Overview
| Name | Lup243 |
|---|
| Genbank ID | CA410908 |
|---|
| Type | Indel |
|---|
| Species | Vicia faba |
|---|
| Primer 1 | Lup243.Forward: CCGATCAACTTACTGATGAAC |
|---|
| Primer 2 | Lup243.Forward primer: ccgatcaacttactgatgaac |
|---|
| Primer 3 | Lup243.Reverse: TAATCATGTCCTGCAACTCA |
|---|
| Primer 4 | Lup243.Reverse Primer: taatcatgtcctgcaactca |
|---|
| Publication | [view all] |
|---|
| Contact | Simon Ellwood
|
|---|
| Comment | Calmodulin |
|---|
References
External references for this genetic_marker
| Database | Accession |
|---|
| DB:genbank | CA410908 |
Alignments
The following features are aligned
Publications
| Year | Publication |
|---|
| 2008 | Ellwood SR, Phan HT, Jordan M, Hane J, Torres AM, Avila CM, Cruz-Izquierdo S, Oliver RP. Construction of a comparative genetic map in faba bean (Vicia faba L.); conservation of genome structure with Lens culinaris. BMC genomics. 2008; 9:380. |
| 2006 | Nelson, MN, Phan HTT, Ellwood SR, Moolhuijzen PM, Hane J, Williams A, O'Lone CE, Fosu-Nyarko J, Scobie M, Cakir M, Jones MGK, Bellgard M, Ksiazkiewicz M, Wolko B, Barker SJ, Oliver RP, Cowling WA. The first gene-based map of Lupinus angustifolius L.-location of domestication genes and conserved synteny with Medicago truncatula. Theor Appl Genet. 2006; 113:225-238. |
|
