|
Marker Overview
Name | PBA_LC_0489 |
Genbank ID | N/A |
Type | EST-SSR |
Species | Lens culinaris |
Repeat Motif | GGT(7) |
Primer 1 | PBA_LC_0489.Forward primer: TGGAGAATGGGTATATGATGA |
Primer 2 | PBA_LC_0489.Reverse primer: CATCACATGATAGAACAAGCA |
Product Length | 151 |
Publication | [view all] |
Contact | John W. Forster Sukhjiwan Kaur
|
Alignments
The following features are aligned
Publications
Year | Publication |
2011 | Kaur S, Cogan NO, Pembleton LW, Shinozuka M, Savin KW, Materne M, Forster JW. Transcriptome sequencing of lentil based on second-generation technology permits large-scale unigene assembly and SSR marker discovery. BMC genomics. 2011; 12:265. |
2016 | Sudheesh S, Rodda MS, Davidson J, Javid M, Stephens A, Slater AT, Cogan NO, Forster JW, Kaur S. SNP-Based Linkage Mapping for Validation of QTLs for Resistance to Ascochyta Blight in Lentil. Frontiers in plant science. 2016; 7:1604. |
|