|
Marker Overview
Name | SSR154 |
Genbank ID | N/A |
Type | SSR |
Species | Lens culinaris |
Repeat Motif | (AC)3ATAG(AC)7(AT)2 |
Primer 1 | SSR154.Forward Primer: GGAATTTATCACACTATCTC |
Primer 2 | SSR154.Reverse Primer: GACTCCCAACTTGTATG |
Max Length | 360 |
Publication | [view all] |
Contact | Michael Baum Sukhjiwan Kaur
|
Publications
Year | Publication |
2005 | Hamwieh A, Udupa SM, Choumane W, Sarker A, Dreyer F, Jung C, Baum M. A genetic linkage map of Lens sp. based on microsatellite and AFLP markers and the localization of fusarium vascular wilt resistance. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Feb; 110(4):669-77. |
2015 | Mekonnen F, Mekbib F, Kumar S, Ahmed S, Sharma TR. Molecular Diversity and Population Structure of the Ethiopian Lentil (Lens Culinaris Medikus) Genotype Assessment Using SSR Markers. Journal of Crop Science and Biotechnology. 2015; 19(1):1-15. |
2016 | Idrissi O, Udupa M, De Keyser E, Van Damme P, De Riek J. Functional Genetic Diversity Analysis and Identification of Associated Simple Sequence Repeats and Amplified Fragment Length Polymorphism Markers to Drought Tolerance in Lentil (Lens culinaris ssp. culinaris Medicus) Landraces. Plant Molecular Biology Reporter. 2016; 2016(34):659-680. |
2016 | Sudheesh S, Rodda MS, Davidson J, Javid M, Stephens A, Slater AT, Cogan NO, Forster JW, Kaur S. SNP-Based Linkage Mapping for Validation of QTLs for Resistance to Ascochyta Blight in Lentil. Frontiers in plant science. 2016; 7:1604. |
|